Product Information: SP6 promoter sequencing primer, 24-mer, #SO117
DE10342373A1 - Verfahren zur Synthese von Nukleinsäuren und deren Anwendung - Google Patents
SP6 Upstream - 5 nmol
mMESSAGE mMACHINE™ SP6 Transkriptionskit
MultiFRAGing: Rapid and Simultaneous Genotyping of Multiple Alleles in a Single Reaction | Scientific Reports
2 pGEM-T EASY plasmid vector showing T7 and SP6 primer locations. | Download Scientific Diagram
HiScribe® SP6 RNA Synthesis Kit | NEB
A fast and efficient polymerase chain reaction‐based method for the preparation of in situ hybridization probes - Ghafoory - 2012 - Histopathology - Wiley Online Library
SP6 RNA Polymerase Promoter Sequencing Primer
Addgene: pAC-SP6
![PDF] Cloning Blunt-End Pfu DNA Polymerase-Generated PCR Fragments into pGEM ®-T Vector Systems | Semantic Scholar](https://d3i71xaburhd42.cloudfront.net/f35c196676257f638aca6bdf939fd5bd07b33916/3-Figure2-1.png "PDF] Cloning Blunt-End Pfu DNA Polymerase-Generated PCR Fragments into pGEM ®-T Vector Systems | Semantic Scholar")
PDF] Cloning Blunt-End Pfu DNA Polymerase-Generated PCR Fragments into pGEM ®-T Vector Systems | Semantic Scholar
pTARGET™ Sequencing Primer
CLOVAPRIME 21 EPOXY PRIMER - PART B (4:1) 3,78L
SP6 Promoter Primer / 19 mer (2 nmole)
LaboShop | Products | Thermo Scientific™ SP6 Promoter Sequencing Primer, 24-mer
cDNA library construction from a small amount of RNA: adaptor-ligation approach for two-round cRNA amplification using T7 and SP6 RNA polymerases | BioTechniques
Table SI. Primers used in the NRAS sequencing. Primer name Primer sequence NRAS exon2 forward primer CAACAGGTTCTTGCTGGTGT NRAS e
Introduction to DNA sequence
Colony PCR of representative E. colitransformantsusing T7-SP6 primers... | Download Scientific Diagram
Primer sequences for the Real-Time RT PCR analysis. | Download Table
Primers - Geneious Prime User Manual
SP6-Promoter - 24-mer
Buy SP6 promoter sequencing primer, 24-mer, 0.1 AU SO117 in India | Biomall
Figure 2 | A Pipeline with Multiplex Reverse Transcription Polymerase Chain Reaction and Microarray for Screening of Chromosomal Translocations in Leukemia
EMBRYS - Embryonic Gene Expression Database as a Biomedical Research Source
