PSF-SP6 - SP6 PROMOTER PLASMID plasmid vector for molecular cloning molecular cloning vector
Addgene: pAC-SP6
A. Schematic representation of the SFV expression vectors. SP6 RNA... | Download Scientific Diagram
Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS
SP6 RNA Polymerase Promoter Sequencing Primer
T7 Promoter - an overview | ScienceDirect Topics
SP6 Promoter Primer - Kloningsverktøy - nmas
Maximizing transcription of nucleic acids with efficient T7 promoters | Communications Biology
Product Information: SP6 promoter sequencing primer, 24-mer, #SO117
Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS
Mind your caps and Poly A tails | NEB
T7 RNA Polymerase-Plus™ and SP6 RNA Polymerase-Plus™ From Ambion | Biocompare Product Review
A fast and efficient polymerase chain reaction‐based method for the preparation of in situ hybridization probes - Ghafoory - 2012 - Histopathology - Wiley Online Library
Structure Analysis of MicroRNA Precursors | SpringerLink
Maximizing transcription of nucleic acids with efficient T7 promoters | Communications Biology
Table SI. Primers used in the NRAS sequencing. Primer name Primer sequence NRAS exon2 forward primer CAACAGGTTCTTGCTGGTGT NRAS e
T7 Promoter Primer
A specific, promoter-independent activity of T7 RNA polymerase suggests a general model for DNA/RNA editing in single subunit RNA Polymerases | Scientific Reports
Buy SP6 promoter sequencing primer, 24-mer, 0.1 AU SO117 in India | Biomall
Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS
Frontiers | Klebsiella Phage KP34 RNA Polymerase and Its Use in RNA Synthesis
Addgene: SP6-sgRNA-scaffold
Nonradioactive In Situ Hybridization: Optimization for Tissue Sections from Pregnant Uteri and Placenta during the First Half of Pregnancy - ScienceDirect
Construction of full-length monomeric cDNA clones of CSVd-SK1. (A)... | Download Scientific Diagram
Part:BBa K2753023 - parts.igem.org
